Datgirlnadia71
Datgirlnadia71 Datgirlnadia71
  • 04-03-2016
  • Mathematics
contestada

A hummingbird has a wing beat of about 200 beats per second how many wing beats would a hummingbird have in 3 minutes

Respuesta :

Airbe
Airbe Airbe
  • 04-03-2016
36000 wing beats with in 3 min ........as.d.as.df.as.df.as.dfa
Answer Link
Аноним Аноним
  • 04-03-2016
This is a rate question. Ok, so we know that there are 60 seconds in 1 minute, so in 3 minutes this is 180 seconds. Now multiply 200 by 180 because its per second, which is 36,000 beats in 3 minutes.
Answer Link

Otras preguntas

A generator stores electric current. Explain why you agree or disagree with this statement
Please answer theses division problems!! 9 divided by 3/7
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
how many cups of water should be mixed with 1/4 cup of vinegar to make the cleaning solution?
the bombing of Hiroshima and Nagasaki resulted in
why is the square root of a perfect square always rational
Complete the sentences with seem, look or sound and use like or as if when necessary. 1) Quick! Emma's an the phone. She... she's calling from a long way away.
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
what was paul revere failures