neehasthara neehasthara

03-11-2020
English

contestada

Although it was raining we went for a walk. which type of sentence is this

Respuesta :

nelk831 nelk831

03-11-2020

It is a simple sentence I think

Answer Link

Otras preguntas

Please help me!! I need to get this right to pass ASAP 1. Isosceles trapezoid TRAP is shown below. What are the coordinates of point T? (-4a, 0) (-b, 0) (0, -4a

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Why were senators able to amass more power and influence than congressmen during the gilded age?

Researchers are exploring whether treatment with ________ might improve social behavior in those with asd.

Given the sequence in the table below, determine the sigma notation of the sum for term 4 through term 15. n an 1 4 2 −12 3 36

help asap homework due soon 20 pts Read each verbal expression Then assign a variable and distribute

which of the following statements agrees with the second law of thermodynamics

With increasing doses of any useful drug there is usually an increase in the number and severity of

PLEASE HELP ASAP simplify (3x^2 - 3 + 9x^3) - (4x^3 - 2x^2 + 16).x^3 - 5x^2 + 25-x^3 + x^2 + 255x^3 + 2x + 13 5x^3 + 5x^2 - 19

What is the value of x?