MrPassMan MrPassMan
  • 02-03-2021
  • Mathematics
contestada

what is the slope and y-intercept to -3x + y = 1

Respuesta :

dkscidmore dkscidmore
  • 02-03-2021

Answer:

Slope = 3

Y intercept = 1

Step-by-step explanation:

Slope intercept form is

y = mx+b where m is the slope and b is the y intercept.

So in your question

-3x+y=1

add 3x to each side to get

y = 3x+1

3 is m

1 is b

so the slope is 3

the y intecept is 1

Answer Link

Otras preguntas

what is the geometric mean between 6 and 20?
COMPARISON; 1. How is concrete like chocolate 2. How is a shirt like a picture 3. how is an elephant like a cloud
what is 0.00001267 is scientific notation
Do you think then solid can undergo convection
What is the range of function of y-1=(x+3)^2
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
A pet store currently has a total of 45 cats and dogs. There are 7 more cats than dogs. Find the number of cats and dogs in the store. Write and solve a system
Round 46.895 to the nearest tenth
Which is the best description of the events of A Midsummer Night's Dream? A. logical and tragic B. serious and historically accurate C. comical and fantasy-l