hola8033 hola8033

03-12-2021
Mathematics

contestada

What is the reciprocal of
4/7

Respuesta :

josephd72 josephd72

03-12-2021

Answer:

7/4

Step-by-step explanation:

it just is

Answer Link

abbysheeesh abbysheeesh

03-12-2021

Answer:

7/4

Step-by-step explanation:

you just flip the places of the numerator and the denominator.

Answer Link

Otras preguntas

Why is it important for scientists to use blind tests?

Both Ghandhi and king set which type of mood in their introduction

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Help! Exponential Equation WITHOUT CALCULATOR

Using the images or terms, describe how parts of a cell interact to export proteins.

How would you describe neville chamberlain's policy toward hitler in the late 1930?

The archetypes established in ancient mythology A. explain scientific phenomena. B. capture historical facts. C. provide ideas for improved cultural interac

Percy Bysshe Shelley's poem "Ode to the West Wind" is significant because it A. explores the human need for love and companionship. B. uses satire to make fun

Under the articles of confederation, political power and authority ultimately rested with the ________.

The reason why vanessa did not include sports skills activities in her program was that she: