sarlette016
sarlette016 sarlette016
  • 01-04-2022
  • Chemistry
contestada

All of the following are sources of air pollution EXCEPT
-mobile sources
- Factories
-scrubbers
-Landfills

Respuesta :

Аноним Аноним
  • 01-04-2022

Answer:

Mobile sources

..........................

Answer Link

Otras preguntas

The length of a rectangle is 4 times its width and the perimeter is 150 feet. What is the width of the rectangle? A. 75 feet B. 30 feet C. 15 feet D. 60 fe
p(x) x^3+x^2-x-1 Find all zeros of p (x)
Which theater is considered Shakespeare's theater? A. The Swan B. The Globe C. The Rose D. The Stage
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
How did i travel irf i went from nyc to tren ton a distance of90 miles at45 miles per hour how long did it take
the reproductive system of a male mammal provides
The area of the base of a prism is 50 mm2. The perimeter of the base is 30 mm. The height of the prism is 7 mm. What is the surface area of the prism?
20 points People disagree whether the United States should have gone to war against Mexico. Should the United States have declared war? Opinions Please The Unit
explain, in terms of atomic structure, why group 18 elements on the periodic table rarely form compounds