anthonynacin anthonynacin

03-03-2017
Mathematics

contestada

you find a case on sale price of $4.51 after a 45% discount what is the original price

Respuesta :

theshammy123 theshammy123

03-03-2017

the original price is $8.20

Answer Link

lexilynnknows lexilynnknows

03-03-2017

I got $6.54 BeCause 1.45*4.51=6.5395, which rounds up to that

Answer Link

Otras preguntas

A mutation that occurs in the gametes of an organism will most likely be transferred where

Mrs. smith underwent an arthrodesis of her spine for spinal deformity, posterior approach, segments l3-l5. what procedure code is reported

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Will bought a package of 24 juice bottles for $7.44. Which equation relates the cost, c, of a package of juice bottles to the number of bottles, b, in the packa

__________ is widely considered to be the founder of the professional american police department.

Do you think social mobility is an easy thing to achieve in the US? Why or why not?

what was a power given by the articles of confederation

What was a major effect of the agricultural revolution in the united states during the late 1800's?

What transportation technology made getting around in cities easier in the mid to late 1800s? A. Automobiles B. Cable cars C. Gondolas D. Horses

Solving this question