cupcake1452 cupcake1452
  • 02-08-2017
  • Spanish
contestada

Which of the following forms should you use when speaking to the principal of your school?

Respuesta :

teck12
teck12 teck12
  • 02-08-2017
You should use the form "Ud" when speaking ti the principal of your school.
Answer Link
fwk
fwk fwk
  • 03-08-2017
When speaking to your principal, you should always use the Usted (Ud.) form as he/she/other is a figure of respect.
Answer Link

Otras preguntas

what is the mRNA sequence from 3 TACGGTAAGCATCTTGGCATAACCCCAATT 5
What is the range of function of y-1=(x+3)^2
How do you put allele in a sentence
Do all your pet's offspring look the same? If no, then explain why they look different.
What is the domain of the relation {(2, 8), (0, 8), (–1, 5), (–1, 3), (–2, 3)}?
a tabletop in the shape a trapezoid has an area of 6550 square centimeters its longer base measures 115 centimeters and the shorter base is 85 centimeters what
Give a recursive algorithm for finding the sum of the first n odd positive integers.
Thank you Philo for your answer. I have one more question for you regarding the same rectangular prism that is 3 units long, 2 units wide and has 7 layers and 4
Jennie had $300. Then she spent $15 on a new shirt. What percent of the money does Jennie have left
Two taps A and B fill a swimming pool together in two hours. Alone, it takes tap A three hours less than B to fill the same pool. How many hours does it take ea